Downregulation of TOP2 modulates neurodegeneration caused by GGGGCC expanded repeats

GGGGCC repeats in a non-coding area of the C9orf72 gene have been recognized as a significant genetic reason for amyotrophic lateral sclerosis (ALS) and frontotemporal dementia. We beforehand confirmed that the GGGGCC expanded repeats alone had been ample to trigger neurodegeneration in Drosophila. Current proof signifies that GGGGCC expanded repeats can modify numerous gene transcriptomes. To find out the function of those genes in GGGGCC-mediated neurotoxicity, we screened a longtime Drosophila mannequin expressing GGGGCC expanded repeats on this examine.

Our outcomes confirmed that knockdown of the DNA topoisomerase II (Top2) gene can particularly modulate GGGGCC-associated neurodegeneration of the attention. Moreover, chemical inhibition of Top2 or siRNA-induced Top2 downregulation might alleviate the GGGGCC-mediated neurotoxicity in Drosophila assessed by eye neurodegeneration and locomotion impairment. In contrast, upregulated Top2 ranges had been detected in Drosophila strains, and furthermore, TOP2A degree was additionally upregulated in Neuro-2a cells expressing GGGGCC expanded repeats, in addition to within the brains of Sod1G93A mannequin mice.

This indicated that elevated ranges of TOP2A could also be concerned in a pathway widespread to the pathophysiology of distinct ALS varieties. Furthermore, by means of RNA-sequencing, a complete of 67 genes, concerned within the pathways of intracellular signaling cascades, peripheral nervous system improvement, et al, had been recognized as potential targets of TOP2A to modulate GGGGCC-mediated neurodegeneration.

Single-cell transcriptomics of the Drosophila wing disc reveals instructive epithelium-to-myoblast interactions

In each vertebrates and invertebrates, producing a purposeful appendage requires interactions between ectoderm-derived epithelia and mesoderm-derived cells. To analyze such interactions, we used single-cell transcriptomics to generate a temporal cell atlas of the Drosophila wing disc from two developmental time factors. Utilizing these information, we visualized gene expression utilizing a multi-layered mannequin of the wing disc and catalogued ligand-receptor pairs that would mediate signaling between epithelial cells and grownup muscle precursors (AMPs).

We discovered that localized expression of the FGF ligands, Thisbe and Pyramus, within the disc epithelium regulates the quantity and placement of the AMPs. As well as, Hedgehog ligand from the epithelium prompts a particular transcriptional program inside adjoining AMP cells, outlined by AMP-specific targets Neurotactin and midline, that’s important for correct formation of direct flight muscle groups. Extra usually, our annotated temporal cell atlas supplies an organ-wide view of potential cell-cell interactions between epithelial and myogenic cells.

Identification and purposeful characterization of odorant-binding proteins 69a and 76a of Drosophila suzukii

The fruit fly Drosophila suzukii is a fruit crop pest that causes a extreme financial risk to smooth summer time fruit worldwide. The male intercourse pheromone, cis-vaccenyl acetate (cVA) has a number of capabilities in intra-species communication in Drosophila melanogaster, which is required in male to suppress male-male courtship. D. suzukii males don’t produce cVA; nonetheless, the odorant receptor for cVA (Or67d) remains to be purposeful. The dearth of cVA in D. suzukii casts the query of whether or not this pheromone may need been changed by one other compound much like cVA that disrupts mating in D. suzukii.

As a way to deal with this query, we cloned two D. suzukii grownup antenna-specific odorant-binding proteins (OBPs) DsOBP69a and DsOBP76a and aligned with their D. melanogaster orthologues. Furthermore, we examined the binding properties of the newly recognized recombinant proteins in opposition to 26 potential ligands together with cVA, utilizing the fluorescence-based ligand binding assay. The alignment confirmed that DsOBP69a and DsOBP76a, have six conserved cysteines and belong to the basic OBP household. Moreover, our outcomes revealed that cVA didn’t bind to DsOBP69a or DsOBP76a proteins.

Curiously, the floral odorant β-ionone and the bitter substance berberine chloride and coumarin displayed excessive binding potential. Additionally it is value noting that DsOBP69a and DsOBP76a have completely different affinities to (Z)-7-Tricosene which will replicate completely different purposeful roles. These findings counsel that DsOBP69a and DsOBP76a are doubtlessly concerned in olfaction and gustation of D. suzukii.

Differential Necessities for Mediator Complicated Subunits in Drosophila melanogaster Host Protection Towards Fungal and Bacterial Pathogens

The humoral immune response to bacterial or fungal infections in Drosophila depends largely on a transcriptional response mediated by the Toll and Immune deficiency NF-κB pathways. Antimicrobial peptides are potent effectors of those pathways and permit the organism to assault invading pathogens. Dorsal-related Immune Issue (DIF), a transcription issue regulated by the Toll pathway, is required within the host protection in opposition to fungal and a few Gram-positive bacterial infections. The Mediator advanced is concerned within the initiation of transcription of most RNA polymerase B (PolB)-dependent genes by forming a purposeful bridge between transcription components certain to enhancer areas and the gene promoter area after which recruiting the PolB pre-initiation advanced. Mediator is fashioned by a number of modules that every contains a number of subunits.

The Med17 subunit of the top module of Mediator has been proven to be required for the expression of Drosomycin, which encodes a potent antifungal peptide, by binding to DIF. Thus, Mediator is predicted to mediate the host protection in opposition to pathogens managed by the Toll pathway-dependent innate immune response. Right here, we first deal with the Med31 subunit of the center module of Mediator and discover that it’s required in host protection in opposition to Aspergillus fumigatus, Enterococcus faecalis, and injected however not topically-applied Metarhizium robertsii.

Thus, host protection in opposition to M. robertsii requires Dif however not essentially Med31 within the two distinct an infection fashions. The induction of some Toll-pathway-dependent genes is decreased after a problem of Med31 RNAi-silenced flies with both A. fumigatus or E. faecalis, whereas these flies exhibit regular phagocytosis and melanization. We’ve additional examined most Mediator subunits utilizing RNAi by monitoring their survival after challenges to a number of different microbial infections recognized to be fought off by means of DIF.

Anti-TH1L antibody
PAab08656	Lifescience Market	100 ug	EUR 386

Anti-TH1L antibody
STJ72414	St John's Laboratory	100 µg	EUR 359

TH1L Recombinant Protein (Mouse)
RP178523	ABM	100 ug	Ask for price

anti-TH1L
YF-PA19082	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TH1L

Th1l ORF Vector (Mouse) (pORF)
ORF059509	ABM	1.0 ug DNA	EUR 506

TH1L Blocking Peptide
33R-3227	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TH1L antibody, catalog no. 70R-9546

TH1L Blocking Peptide
DF12771-BP	Affbiotech	1mg	EUR 195

TH1L cloning plasmid
CSB-CL815573HU-10ug	Cusabio	10ug	EUR 607
Formulation: 10 Î¼g plasmid + 200Î¼l Glycerol Length: 1773 Sequence: atggcgggggccgtgccgggcgccatcatggacgaggactactacgggagcgcggccgagtggggcgacgaggctgacggcggccagcaggaggatgattctggagaaggagaggatgatgcggaggttcagcaagaatgcctgcataaattttccacccgggattatatcatgg Show more
Description: A cloning plasmid for the TH1L gene.

Anti-TH1L (3C9)
YF-MA18524	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to TH1L

TH1-Like (Drosophila) (TH1L) Antibody
abx122033-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

TH1-Like (Drosophila) (TH1L) Antibody
abx029378-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

TH1-Like (Drosophila) (TH1L) Antibody
abx029378-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

TH1-Like (Drosophila) (TH1L) Antibody
abx238656-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

TH1-Like (Drosophila) (TH1L) Antibody
abx432026-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Th1l sgRNA CRISPR Lentivector set (Mouse)
K3786501	ABM	3 x 1.0 ug	EUR 339

TH1L ELISA KIT\|Human
EF003575	Lifescience Market	96 Tests	EUR 689

TH1L Recombinant Protein (Human)
RP031426	ABM	100 ug	Ask for price

Th1l sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3786502	ABM	1.0 ug DNA	EUR 154

Th1l sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3786503	ABM	1.0 ug DNA	EUR 154

Th1l sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3786504	ABM	1.0 ug DNA	EUR 154

TH1L Protein Vector (Mouse) (pPB-C-His)
PV238034	ABM	500 ng	EUR 603

TH1L Protein Vector (Mouse) (pPB-N-His)
PV238035	ABM	500 ng	EUR 603

TH1L Protein Vector (Mouse) (pPM-C-HA)
PV238036	ABM	500 ng	EUR 603

TH1L Protein Vector (Mouse) (pPM-C-His)
PV238037	ABM	500 ng	EUR 603

TH1L ORF Vector (Human) (pORF)
ORF010476	ABM	1.0 ug DNA	EUR 95

Ceruloplasmin Mouse, purified
CP16-N-25	Alpha Diagnostics	25 ug	EUR 225

Purified Mouse Hemoglobin
HEMG17-N-1	Alpha Diagnostics	1 mg	EUR 225

Mouse Negative elongation factor D, Th1l ELISA KIT
ELI-42483m	Lifescience Market	96 Tests	EUR 865

TH1L sgRNA CRISPR Lentivector set (Human)
K2367101	ABM	3 x 1.0 ug	EUR 339

Mouse Negative elongation factor C/D(TH1L) ELISA kit
E03N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Negative elongation factor C/D(TH1L) ELISA kit
E03N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Negative elongation factor C/D(TH1L) ELISA kit
E03N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Haptoglobin Mouse, purified protein
HGLB11-N-25	Alpha Diagnostics	25 ug	EUR 225

Hemopexin Mouse, purified protein
HPEX16-N-25	Alpha Diagnostics	25 ug	EUR 225

Rabbit Anti-Human Haptoglobin Polyclonal Antibody(Affinity Purified)
DPAB2047RH	Creative Diagnostics	1mg	EUR 580

Th1l sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3786505	ABM	3 x 1.0 ug	EUR 376

ELISA kit for Mouse Negative elongation factor C/D (TH1L)
KTE70377-48T	Abbkine	48T	EUR 332
The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by TH1L is an essential part of the NELF complex. Alternative translation initiation site usage resul Show more
Description: Quantitative sandwich ELISA for measuring Mouse Negative elongation factor C/D (TH1L) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Negative elongation factor C/D (TH1L)
KTE70377-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by TH1L is an essential part of the NELF complex. Alternative translation initiation site usage resul Show more
Description: Quantitative sandwich ELISA for measuring Mouse Negative elongation factor C/D (TH1L) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Negative elongation factor C/D (TH1L)
KTE70377-96T	Abbkine	96T	EUR 539
The NELF complex of proteins interacts with the DSIF protein complex to repress transcriptional elongation by RNA polymerase II. The protein encoded by TH1L is an essential part of the NELF complex. Alternative translation initiation site usage resul Show more
Description: Quantitative sandwich ELISA for measuring Mouse Negative elongation factor C/D (TH1L) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human TH1-Like (Drosophila) (TH1L) ELISA Kit
abx383733-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

TH1L sgRNA CRISPR Lentivector (Human) (Target 1)
K2367102	ABM	1.0 ug DNA	EUR 154

TH1L sgRNA CRISPR Lentivector (Human) (Target 2)
K2367103	ABM	1.0 ug DNA	EUR 154

TH1L sgRNA CRISPR Lentivector (Human) (Target 3)
K2367104	ABM	1.0 ug DNA	EUR 154

TH1L Protein Vector (Human) (pPB-C-His)
PV041901	ABM	500 ng	EUR 329

TH1L Protein Vector (Human) (pPB-N-His)
PV041902	ABM	500 ng	EUR 329

TH1L Protein Vector (Human) (pPM-C-HA)
PV041903	ABM	500 ng	EUR 329

TH1L Protein Vector (Human) (pPM-C-His)
PV041904	ABM	500 ng	EUR 329

Th1l 3'UTR Luciferase Stable Cell Line
TU120436	ABM	1.0 ml	Ask for price

Th1l 3'UTR GFP Stable Cell Line
TU170436	ABM	1.0 ml	Ask for price

TH1L 3'UTR GFP Stable Cell Line
TU075510	ABM	1.0 ml	EUR 1394

TH1L 3'UTR Luciferase Stable Cell Line
TU025510	ABM	1.0 ml	EUR 1394

Mouse anti-Human CD4, Purified mAbConjugated Antibody
C28010	SAB	100ul	EUR 397

Mouse anti-Human CD8, Purified mAbConjugated Antibody
C28025	SAB	100ul	EUR 397

Mouse anti-Human CD14, Purified mAbConjugated Antibody
C28050	SAB	100ul	EUR 397

Mouse anti-Human CD19, Purified mAbConjugated Antibody
C28071	SAB	100ul	EUR 397

Mouse anti-Human CD45, Purified mAbConjugated Antibody
C28141	SAB	100ul	EUR 397

Purified AAV-6 Antibody
10R-2480AP	Fitzgerald	50 ug	EUR 648
Description: Purified Anti-AAV-6 Monoclonal Antibody

Mouse IgG Fab fragment, purified
20008-1-FAB	Alpha Diagnostics	1 mg	EUR 164

Mouse IgG (Fc) fragment, purified
20008-1-FC	Alpha Diagnostics	0.5 mg	EUR 250

Mouse IgA isotype control, purified
20102-100	Alpha Diagnostics	100 ug	EUR 164

Mouse IgG1 isotype control, purified
20102-101	Alpha Diagnostics	100 ug	EUR 141

Mouse IgG2a isotype control, purified
20102-102	Alpha Diagnostics	100 ug	EUR 141

Mouse IgG2b isotype control, purified
20102-103	Alpha Diagnostics	100 ug	EUR 141

Mouse IgG3 isotype control, purified
20102-104	Alpha Diagnostics	100 ug	EUR 141

Mouse IgM isotype control, purified
20102-105	Alpha Diagnostics	100 ug	EUR 141

Mouse IgE isotype control, purified
20102-106	Alpha Diagnostics	100 ug	EUR 164

Mouse IgG2c isotype control, purified
20102-107	Alpha Diagnostics	100 ug	EUR 202

Mouse IgG1 Isotype Control Purified
11-457-C025	ExBio	0.025 mg	EUR 88

Mouse IgG1 Isotype Control Purified
11-457-C100	ExBio	0.1 mg	EUR 136

Mouse IgG2a Isotype Control Purified
11-458-C025	ExBio	0.025 mg	EUR 88

Mouse IgG2a Isotype Control Purified
11-458-C100	ExBio	0.1 mg	EUR 136

Mouse IgG3 Isotype Control Purified
11-459-C025	ExBio	0.025 mg	EUR 88

Mouse IgG3 Isotype Control Purified
11-459-C100	ExBio	0.1 mg	EUR 136

Mouse IgG1 Isotype Control Purified
11-632-C025	ExBio	0.025 mg	EUR 87

Mouse IgG1 Isotype Control Purified
11-632-C100	ExBio	0.1 mg	EUR 136

Mouse IgG2b Isotype Control Purified
11-692-C025	ExBio	0.025 mg	EUR 88

Mouse IgG2b Isotype Control Purified
11-692-C100	ExBio	0.1 mg	EUR 136

Mouse IgG2a Isotype Control Purified
11-724-C025	ExBio	0.025 mg	EUR 88

Mouse IgG2a Isotype Control Purified
11-724-C100	ExBio	0.1 mg	EUR 136

Mouse IgG2b Isotype Control Purified
11-801-C025	ExBio	0.025 mg	EUR 88

Mouse IgG2b Isotype Control Purified
11-801-C100	ExBio	0.1 mg	EUR 136

Mouse IgM Isotype Control Purified
11-803-C025	ExBio	0.025 mg	EUR 87

Mouse IgM Isotype Control Purified
11-803-C100	ExBio	0.1 mg	EUR 136

Antithrombin III, Mouse Plasma, purified
ATH36-N-100	Alpha Diagnostics	100 ug	EUR 225

Myoglobin Mouse Cardiac, purified protein
MYG15-N-25	Alpha Diagnostics	25 ug	EUR 225

Mouse Recombinant purified Resistin protein
RSTN15-R	Alpha Diagnostics	5 ug	EUR 324

Mouse Recombinant purified Resistin protein
RSTN15-R-25	Alpha Diagnostics	25 ug	EUR 773

Purified GFP
AG45-0205-Z	Immunology Consultants Laboratory	0.1 mg	EUR 228

Ovalbumin, purified
O705084	Bio Basic	1g	EUR 67.4
Product category: Proteins/Recombinant Proteins/Other

Th1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3786506	ABM	1.0 ug DNA	EUR 167

Th1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3786507	ABM	1.0 ug DNA	EUR 167

Th1l sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3786508	ABM	1.0 ug DNA	EUR 167

Porcine Negative elongation factor D, TH1L ELISA KIT
ELI-42484p	Lifescience Market	96 Tests	EUR 928

anti-LBR antibody, affinity-purified
70-301	Sceti	50ug	EUR 362
Description: The anti-LBR antibody, affinity-purified is available in Europe and for worldwide shipping via Gentaur.

HIV1 p24 antibody (IgG purified)
20-000702	Fitzgerald	100 ug	EUR 317
Description: Sheep polyclonal HIV1 p24 antibody (IgG purified)

Mouse (non-immune) Serum IgM, purified
20008-2	Alpha Diagnostics	100 ug	EUR 141

Mouse (non-immune) Serum IgG, purified
20008-25	Alpha Diagnostics	25 mg	EUR 469

Mouse anti-Human CD3, Purified mAb
28003-100ul	SAB	100ul	EUR 252

Mouse anti-Human CD4, Purified mAb
28010-100ul	SAB	100ul	EUR 252

Mouse anti-Human CD8, Purified mAb
28025-100ul	SAB	100ul	EUR 252

Mouse anti-Human CD14, Purified mAb
28050-100ul	SAB	100ul	EUR 252

Mouse anti-Human CD19, Purified mAb
28071-100ul	SAB	100ul	EUR 252

Mouse anti-Human CD45, Purified mAb
28141-100ul	SAB	100ul	EUR 252

Mouse monoclonal Anti-Bovine IgG1, purified
80654-U	Alpha Diagnostics	100 ug	EUR 408

Mouse liver ferritin purified, ELISA grade
FERT20-R-50	Alpha Diagnostics	50 ug	EUR 408

Mouse Recombinant (E.Coli) Purified Leptin Protein
LEP11-R-1000	Alpha Diagnostics	1 mg	EUR 286

Mouse Recombinant (E.Coli) Purified Leptin Protein
LEP11-R-5000	Alpha Diagnostics	5 mg	EUR 895

Recombinant Mouse Myeloperoxidase (MPO) Purified Protein
MPO17-R-50	Alpha Diagnostics	50 ug	EUR 347

Rat Negative elongation factor C/D(TH1L) ELISA kit
E02N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Negative elongation factor C/D(TH1L) ELISA kit
E02N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Negative elongation factor C/D(TH1L) ELISA kit
E02N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Negative elongation factor C/D(TH1L) ELISA kit
E01N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Negative elongation factor C/D(TH1L) ELISA kit
E01N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Negative elongation factor C/D(TH1L) ELISA kit
E01N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Negative elongation factor C/D(TH1L) ELISA kit
E04N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Negative elongation factor C/D(TH1L) ELISA kit
E04N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Negative elongation factor C/D(TH1L) ELISA kit
E04N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Negative elongation factor C/D(TH1L) ELISA kit
E06N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Negative elongation factor C/D(TH1L) ELISA kit
E08N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Negative elongation factor C/D(TH1L) ELISA kit
E08N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Negative elongation factor C/D(TH1L) ELISA kit
E08N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Negative elongation factor C/D(TH1L) ELISA kit
E07N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Negative elongation factor C/D(TH1L) ELISA kit
E07N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Negative elongation factor C/D(TH1L) ELISA kit
E07N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Negative elongation factor C/D(TH1L) ELISA kit
E06N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Negative elongation factor C/D(TH1L) ELISA kit
E06N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Negative elongation factor C/D(TH1L) ELISA kit
E09N0576-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Negative elongation factor C/D(TH1L) ELISA kit
E09N0576-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Negative elongation factor C/D(TH1L) ELISA kit
E09N0576-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE1 vial 3. STANDARD A1 vial 4. STANDARD B1 vial 5. STANDARD C1 vial 6. STANDARD D1 vial 7. STANDARD E1 vial 8. STANDARD F1 vial 9. SUBSTRATE A1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Negative elongation factor C/D(TH1L) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Negative elongation factor C/D, TH1L ELISA KIT
ELI-39579h	Lifescience Market	96 Tests	EUR 824

Anti-Cytokeratins Purified
11-108-C025	ExBio	0.025 mg	EUR 99

Anti-Cytokeratins Purified
11-108-C100	ExBio	0.1 mg	EUR 158

Anti-MFG Purified
11-113-C025	ExBio	0.025 mg	EUR 90

Anti-MFG Purified
11-113-C100	ExBio	0.1 mg	EUR 140

Anti-p53 Purified
11-114-C025	ExBio	0.025 mg	EUR 104

Anti-p53 Purified
11-114-C100	ExBio	0.1 mg	EUR 167

Anti-CDK1 Purified
11-115-C025	ExBio	0.025 mg	EUR 108

Anti-CDK1 Purified
11-115-C100	ExBio	0.1 mg	EUR 177

Anti-hTSH Purified
11-124-C025	ExBio	0.025 mg	EUR 90

Anti-hTSH Purified
11-124-C100	ExBio	0.1 mg	EUR 140

Anti-hTSH Purified
11-125-C025	ExBio	0.025 mg	EUR 90

Anti-hTSH Purified
11-125-C100	ExBio	0.1 mg	EUR 140

Anti-hGH Purified
11-126-C025	ExBio	0.025 mg	EUR 99

Anti-hGH Purified
11-126-C100	ExBio	0.1 mg	EUR 158

Anti-Lactoferrin Purified
11-128-C025	ExBio	0.025 mg	EUR 99

Anti-Lactoferrin Purified
11-128-C100	ExBio	0.1 mg	EUR 158

Anti-Ikaros Purified
11-159-C025	ExBio	0.025 mg	EUR 99

Anti-Ikaros Purified
11-159-C100	ExBio	0.1 mg	EUR 158

Anti-PCNA Purified
11-182-C025	ExBio	0.025 mg	EUR 99

Anti-PCNA Purified
11-182-C100	ExBio	0.1 mg	EUR 158

Anti-NG2 Purified
11-199-C025	ExBio	0.025 mg	EUR 99

Anti-NG2 Purified
11-199-C100	ExBio	0.1 mg	EUR 158

Anti-Insulin Purified
11-246-C025	ExBio	0.025 mg	EUR 99

Anti-Insulin Purified
11-246-C100	ExBio	0.1 mg	EUR 158

Anti-MAP2 Purified
11-253-C025	ExBio	0.025 mg	EUR 113

Anti-MAP2 Purified
11-253-C100	ExBio	0.1 mg	EUR 186

Anti-Vimentin Purified
11-254-C025	ExBio	0.025 mg	EUR 113

Anti-Vimentin Purified
11-254-C100	ExBio	0.1 mg	EUR 186

Anti-GFAP Purified
11-255-C025	ExBio	0.025 mg	EUR 113

Anti-GFAP Purified
11-255-C100	ExBio	0.1 mg	EUR 186

Anti-Transferrin Purified
11-258-C025	ExBio	0.025 mg	EUR 99

Anti-Transferrin Purified
11-258-C100	ExBio	0.1 mg	EUR 158

Anti-HRP Purified
11-262-C025	ExBio	0.025 mg	EUR 90

Anti-HRP Purified
11-262-C100	ExBio	0.1 mg	EUR 140

Anti-Phosphotyrosine Purified
11-263-C025	ExBio	0.025 mg	EUR 113

Anti-Phosphotyrosine Purified
11-263-C100	ExBio	0.1 mg	EUR 186

We report that the host protection in opposition to particular pathogens includes a definite set of Mediator subunits with just one subunit for C. glabrata or Erwinia carotovora carotovora, a minimum of one for M. robertsii or a considerably prolonged repertoire for A. fumigatus (a minimum of eight subunits) and E. faecalis (eight subunits), with two subunits, Med6 and Med11 being required solely in opposition to A. fumigatus. Med31 however not Med17 is required in combating off injected M. robertsii conidia. Thus, the involvement of Mediator in Drosophila innate immunity is extra advanced than anticipated.

Tags : biology cells notes, biology cells parts, biology cells pdf, biology cells practice test, biology cells questions, biology cells quiz, biology cells quiz 3, biology cells quizlet, biology cells review, biology cells revision flashcards gcse, biology cells revision notes gcse, biology cells study, biology cells study guide, biology cells test, biology cells unit, biology cells unit test, biology cells unit test answers, biology cells worksheet, biology cells worksheets answers, biology cells worksheets pdf, cannabis assay kits, creatinine assay kits, elisa kits china, elisa kits companies, elisa kits definition, elisa kits distributor all over the world, elisa kits distributor list, elisa kits for chemokines, elisa kits for covid 19, elisa kits manufacturer, elisa kits manufacturer in india, elisa kits nigeria, elisa kits r&d systems, elisa kits thermo fisher, enzymes are quizlet, enzymes definition, enzymes for adhesions, enzymes for cats, enzymes for digestion, enzymes for digestion of lipids, enzymes for dogs, enzymes for dogs joints, enzymes for drain, enzymes for drain pipes, enzymes for fat, enzymes for gluten, enzymes for heart, mineral assay kits, msd assay kits, v

The Drosophila Testis Gene Expression Database